tariqobrien440 tariqobrien440
  • 01-11-2018
  • Computers and Technology
contestada

When using a search engine, what is the name of a word or phrase somebody types to find something online?

Respuesta :

holisticfox holisticfox
  • 02-11-2018
Keyword, also called a search query.. this refers to a word or phrase that helps to describe the content being searched.
Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
4.2meters= how many centimeter
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
does a human body use neon???
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
What is the primary purpose of the Supremacy Clause?