emilyjean2504 emilyjean2504
  • 04-02-2020
  • English
contestada

Make this sentence less redundant

This is an unexpected surprise!

Respuesta :

lindseydweis lindseydweis
  • 04-02-2020

Answer:

This is a huge surprise!

Explanation:

By definition a surprise is going to be unexpected, which is why the sentence is redundant.  

Answer Link

Otras preguntas

if an unknown sample solution is prepared by diluting 10.00 ml of the original solution to a total volume of 100.0 ml with deionized water, what is the dilution
John's age is 9 more than three times Rick's age. Which expression represents this? a. 3 x + 9 b. 9 + x + 3 c. 9 x + 3
how many pouds of blue berryes can you buy for 13.00
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
The moon_around the earth.​
Question: How does one attain happiness and is happiness achievable?
Bertha is making a video about famous American men and women of the early nineteenth century. She needs an accurate description of their lives and achievements
I’m struggling help
one square meter is equal to ten thousandsquare centimetres?​
Find the volume of this rectangular prism ​