JussEditx JussEditx

03-09-2020
History

contestada

How are a
region's religion and society related? Give an example.

Respuesta :

bristhebestwasuptho bristhebestwasuptho

03-09-2020

Answer:

it is related because if the religion says you can't do specific things then it changes the society and it igh look different from other peoples societies.

Explanation:

:)

Answer Link

Otras preguntas

A pp plant is making gametes. how many types of gametes, and in what proportions, will there be

what's the ph of citric acid

you rent a well-lit flat in philidelpia for $1,080 per month. your landlord, knowing that new apatments are being built nearby, decreases you rent by 3%each yea

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Carbohydrates are an important macronutrient for fueling muscles. during exercise, where can the body obtain carbohydrate?

What is the French name for the Hall of Mirrors? What is the Avenue Trianon?

Asexual reproduction _____. see concept 13.1 (page 255) asexual reproduction _____. see concept 13.1 (page 255) leads to a loss of genetic material requires bo

What are the asymptotes of the hyperbola with equation 9y^2 - 4x^2 = 36?

Which option would best fit in this diagram in the bubble labeled 1?

When did christianity become the official religion of the roman empire?