dcauzzort
dcauzzort dcauzzort
  • 02-10-2020
  • Chemistry
contestada

16. A baseball has a mass of 1500 grams and displaces 500 ml. of water. What is
it's density?

Respuesta :

dsdrajlin
dsdrajlin dsdrajlin
  • 10-10-2020

Answer:

3.00 g/mL

Explanation:

Step 1: Given data

Mass of the baseball (m): 1500 g

Volume of the baseball = Volume of water displaced (V): 500 mL

Density of the baseball (ρ): ?

Step 2: Calculate the density of the baseball

The density is equal to the mass divided by the volume.

ρ = m/V

ρ = 1500 g/500 mL

ρ = 3.00 g/mL

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
I=$310 P==$1,000 t=5 years
Can you plz help me I don’t know what alliteration I tried searching it up on google but I don’t understand
Throughout most of the war, southern forces suffered from a chronic shortage of food and supplies. a. True b. False
Classify this triangle... sides 4 ,7, 10
You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per
which combination of quarks produces a neutral baryon
help quick please!! Thanks
What are at least three differences between apes and humans in the cranium and teeth?
Sam is eating a Big Hamburger. The first bite was 20% of the Hamburger, the second bite was 20% of what is left and so every next bite is 20% of what is left. a