lauraaa8 lauraaa8

02-12-2020
Mathematics

contestada

12.7 m
11 m
14 m
16 m
9.5m
what is the volume of the trapezoid prism ?

Respuesta :

ijbhgmjj7q ijbhgmjj7q

02-12-2020

What are the measurements for the prism

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP ASAP A diagonal length of a rhombus is multiplied by 2/3. Which of the following describes the effect of this change on the area?

Sequence the skeletal and muscular changes that take place when a person inhales

Can you plz help me I don’t know what alliteration I tried searching it up on google but I don’t understand

How did president franklin roosevelt respond to adolf hitler's attack on the soviet union in june 1941?

What is the solution 4x+1y ≤48 and 10 ≤y ?

Classify this triangle... sides 4 ,7, 10

The non-proliferation treaty attempts to prevent the spread of __________ weapons.

In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.

The "aha!" moment demonstrated by wolfgang kohler's work with chimpanzees demonstrates: