moudhi2007 moudhi2007
  • 03-04-2021
  • English
contestada

cause and effect about the story flowers for Algernon

pls help asap

Respuesta :

hectorwest77 hectorwest77
  • 03-04-2021
Algernon was a mouse to smart so people wanted to sabotage the mouse by saying a human can be more smart at the same high level of iQ
Answer Link

Otras preguntas

explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
I want to work with LDAP. what is LDAP?
what are 2 examples of ionic compound?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
the reproductive system of a male mammal provides
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5