crystal57 crystal57

01-12-2016
Mathematics

contestada

How many children can be served 1 cup of cider from a total of 4 gallons of cider?

Respuesta :

Аноним Аноним

01-12-2016

21 1/3 children will be served with the amount of 4 gallons of cider.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The stroop effect demonstrates people's inability to ignore the ______ of words.

You must have your insurance ID card with you every time you drive in Florida. A. True B. False

With increasing doses of any useful drug there is usually an increase in the number and severity of

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

Occurs/Exists when the owner-manager makes all major decisions and monitors all activities while the staff serves as an extension of the managers supervisory a

if the volume of a triangular prism is 120 base l is is 6 and base h is is 5 what is the height

The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.

What physical properties must the substances in a mixture have to use filtration to seperate the substances?

Solve for x in terms of the other matrices and/or their inverses. x=b+ax