simmskimarly simmskimarly
  • 04-06-2021
  • Social Studies
contestada

where did we get escoveitched fish and bammy​

Respuesta :

monkeraccoon
monkeraccoon monkeraccoon
  • 04-06-2021
Escovietched fish and bammy is the result of combining the food of two cultures – escoveitched fish from the Spaniards and bammy from the Tainos. We also have the Spaniards to thank for stewed peas with cured meat, oxtail and cow foot, as well frying as a method of cooking.
Answer Link

Otras preguntas

Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
2ln(5x)=8 solve for x
4(3-5)=-2(8-z)-6z what is z
how can you write 0.45 as fraction and a percentage ,please show work
How did the mountains in Greece contribute to the rise of city-states?
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
In which system of government would states function independently of each other?