nia22540 nia22540
  • 01-04-2022
  • Mathematics
contestada

Last one i promise but i need help

Last one i promise but i need help class=
Last one i promise but i need help class=
Last one i promise but i need help class=

Respuesta :

johnjohnjohn23131 johnjohnjohn23131
  • 01-04-2022

Answer:

a

Step-by-step explanation:

Answer Link

Otras preguntas

The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Please answer theses division problems!! 9 divided by 3/7
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
What is the additive inverse of -4a
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420