xxxagarioguyxxx
xxxagarioguyxxx xxxagarioguyxxx
  • 03-05-2017
  • Health
contestada

Which stage of dying is most likely characterized by a patient saying "NO,itt's not my time to die"?

Respuesta :

Okaylah
Okaylah Okaylah
  • 03-05-2017
The answer could be Denial because they do not believe it is their time to go yet.
Answer Link
addisonfakkke
addisonfakkke addisonfakkke
  • 03-05-2017
The stage would be denial.
Answer Link

Otras preguntas

Helppp covert these into decimals and then tell me the ascending order (small to big)
what basic principle is this the people are the source of all government authority
Who is the first person in the world?​
0.2(-4–2.5b–7c). write the product
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Please help- Select the correct measurements Identify The quantities that are equivalent to 250 meters. Ratio Conversation Table Kilometer (km) : meter (m) | 1:
Solve for x ……………….?
David biked a trail on a mountain. The highest the trail went was 5 meters above sea level. The lowest the trail went was 34 meters below sea level. What is the
solve for x!! helppppp
HELP ME OUT PLEASE! Mental health issues are like any other illness; not the fault of the individual but caused by things like genetics and traumatic experience