cassadeertte
cassadeertte cassadeertte
  • 04-06-2017
  • Mathematics
contestada

Does anyone know this? X=?

Does anyone know this X class=

Respuesta :

ghanami
ghanami ghanami
  • 04-06-2017
hello: 
88 = 2(2x)
4x = 88 
x=22
Answer Link

Otras preguntas

an integer is one more than four times another. if the product of two integers is 39, then find the integers
Which type of bone has the least amount of spongy bone relative to its total volume?
How did the Hellenistic kings spread Greek culture
behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false
plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.
What is foster’s overall point about journeys or trips in literature?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
An employee working in a machine shop is exposed to three different sources which emit noises at 81 dB, 91 dB, and 88 dB. What is the combined noise level expos
Do you think social mobility is an easy thing to achieve in the US? Why or why not?
what does a light year measure