jenmdorseyp2q40i jenmdorseyp2q40i

02-03-2018
Mathematics

contestada

Find the area of the square with side lengths 1/6 foot

Respuesta :

choixongdong choixongdong

02-03-2018

A = a^2 = (1/6)^2 = 1/36

answer
Area of square = 1/36 ft^2

Answer Link

Otras preguntas

Which words from the text predict the nature of the coming civil war? jeopardy, bitterly, crisis famous, dissatisfied, possessions regulate, foreshadowed, platf

Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254

If the measures of two opposite angles of a parallelogram are represented by 3x+40 and x+50 what is the measure of each angle of the parallelogram

define intrinsic motivation

Who was the u.s. general fired during the korean war for trying to create another world war with china?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Abraham lincoln's and andrew johnson's reconstruction plans shared an emphasis on

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

Can things of aluminum have a greater mass than things made of iron?

which of the following countries did the u.s. lend-lease military equipment to A. Germany B. spain C.great britian D.italy